microRNA (cel-miR-39) Spike-In Kit: Reliable Normalisation for Low-Abundance RNA Samples
The microRNA (cel-miR-39) Spike-In Kit is a high-precision tool designed for researchers performing quantitative analysis of small RNAs, particularly in samples where endogenous controls are unreliable. In many liquid biopsy applications, such as the analysis of plasma, serum, or urine, RNA yields are often below the detection limit of traditional spectrophotometry. This kit provides a synthetic, quantified RNA sequence (cel-miR-39) that serves as an exogenous reference, allowing for the accurate standardisation of RNA starting quantities across different samples and experimental runs.
The technology utilizes a well-accepted microRNA sequence from Caenorhabditis elegans that lacks homology to mammalian sequences, ensuring zero cross-reactivity. By introducing a known quantity of cel-miR-39 during the RNA extraction procedure, the recovered spike-in RNA directly correlates with the total RNA recovery. Following reverse transcription, the levels of cel-miR-39 are determined via RT-qPCR or Next Generation Sequencing (Small RNA-Seq), enabling the use of methods such as ∆∆Ct relative quantification to normalise target transcript levels and account for technical variability.
Key Benefits:
- Accurate Data Normalisation: Standardise Gene Expression Results. Provides a consistent reference point to correct for sample-to-sample variation in extraction efficiency and input quantity.
- Optimised for Liquid Biopsies: Ideal for Low-Abundance Samples. Specifically developed for use with plasma, serum, and urine where traditional “housekeeping” genes may be absent or unstable.
- Multi-Platform Compatibility: Versatile Workflow Integration. Fully compatible with Norgen’s microScript cDNA synthesis, SYBR Green RT-qPCR, and ligation-based Small RNA-Seq library preparation.
- High Specificity: Zero Mammalian Cross-Reactivity. The synthetic cel-miR-39 sequence ensures high specificity during amplification without background interference from human, mouse, or rat samples.
- Efficiency Tracking: Monitor Library Construction. Enables researchers to track library construction efficiency and monitor recovery rates throughout the entire sample preparation pipeline.
Technical Insights
▼ View Technical Data and Figures
Figure 1: Accurate Quantity and High Quality cel-miR-39 Spike-In
Figure 1. Accurate Quantity and High Quality cel-miR-39 Spike-In. Various quantities of the reconstituted cel-miR-39 RNA was used as spike-in during isolation of urinary RNA (1 mL) using Norgen’s Urine Exosome RNA Isolation Kit. Isolated RNA was reverse transcribed followed by qPCR using Norgen’s 2X PCR Master Mix supplemented with SYBR Green I. The cel-miR-39 RNA was successfully detected in all samples, with the Ct values distributed according to the amount of RNA spiked-in.
Figure 2: Successful Incorporation into Small RNA-Seq Library
Figure 2. Successful Incorporation of cel-miR-39 Spike-In into Small RNA-Seq Library. Small RNA-Seq Library was generated using either a competitor’s or Norgen’s cel-miR-39 Spike-In RNA at two concentrations. The library was generated using Illumina’s TruSeq Small RNA Library Preparation Kit and resolved on a PAGE gel. Only Norgen’s cel-miR-39 RNA showed effective incorporation (Red Arrows), whereas the competitor’s version yielded only adapter dimers (Yellow Arrows) equivalent to the No Template Control (NTC).
Specifications
- Control Type: Synthetic exogenous microRNA (C. elegans cel-miR-39-3p)
- Sequence: 5’ – UCACCGGGUGUAAAUCAGCUUG – 3’
- Format: Lyophilised RNA (requires reconstitution)
- Applications: RT-qPCR Normalisation, Extraction Control, miRNA Profiling, NGS Library Construction
- Compatibility: Works with all major silica-column or phenol-chloroform RNA extraction methods
- Storage: Store at -20°C (stable for 12 months); store aliquots at -80°C after reconstitution
- Kit Components: Synthetic cel-miR-39 RNA and matching forward PCR primer